docs: fix typo in docker tag

README.md

@@ -128,7 +128,7 @@ To build a docker image in this repo:
 
     make docker-image
 
-This will create biocommons/seqrepo-rest-service:lastest, like this:
+This will create biocommons/seqrepo-rest-service:latest, like this:
 
     $ docker images 
     REPOSITORY                        TAG     IMAGE ID       CREATED          SIZE
@@ -150,4 +150,4 @@ You should then be able to fetch a test sequence like this:
     $ curl 'http://127.0.0.1:5000/seqrepo/1/sequence/refseq:NM_000551.3?end=20'
     CCTCGCCTCCGTTACAACGG
 
-If things aren't working, check the logs with `docker logs -f seqrepo-rest-service`.
+If things aren't working, check the logs with `docker logs -f seqrepo-rest-service`.