-
Notifications
You must be signed in to change notification settings - Fork 9
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
Showing
18 changed files
with
198 additions
and
10 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
[run] | ||
source = polypolish |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,145 @@ | ||
""" | ||
This module contains some tests for Polypolish. To run them, execute `pytest` from the root | ||
Polypolish directory. | ||
Copyright 2021 Ryan Wick (rrwick@gmail.com) | ||
https://github.com/rrwick/Polypolish | ||
This file is part of Polypolish. Polypolish is free software: you can redistribute it and/or modify | ||
it under the terms of the GNU General Public License as published by the Free Software Foundation, | ||
either version 3 of the License, or (at your option) any later version. Polypolish is distributed | ||
in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of | ||
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more | ||
details. You should have received a copy of the GNU General Public License along with Polypolish. | ||
If not, see <http://www.gnu.org/licenses/>. | ||
""" | ||
|
||
import gzip | ||
import pytest | ||
import sys | ||
import unittest.mock | ||
|
||
import polypolish.misc | ||
|
||
|
||
def test_get_compression_type_1(): | ||
assert polypolish.misc.get_compression_type('test/test_misc/test.txt') == 'plain' | ||
|
||
|
||
def test_get_compression_type_2(): | ||
assert polypolish.misc.get_compression_type('test/test_misc/test.gz') == 'gz' | ||
|
||
|
||
def test_get_compression_type_3(): | ||
with pytest.raises(SystemExit) as e: | ||
polypolish.misc.get_compression_type('test/test_misc/test.bz2') | ||
assert 'cannot use bzip2' in str(e.value) | ||
|
||
|
||
def test_get_compression_type_4(): | ||
with pytest.raises(SystemExit) as e: | ||
polypolish.misc.get_compression_type('test/test_misc/test.zip') | ||
assert 'cannot use zip' in str(e.value) | ||
|
||
|
||
def test_get_open_func_1(): | ||
assert polypolish.misc.get_open_func('test/test_misc/test.txt') == open | ||
|
||
|
||
def test_get_open_func_2(): | ||
assert polypolish.misc.get_open_func('test/test_misc/test.gz') == gzip.open | ||
|
||
|
||
def test_load_fasta_1(): | ||
seqs = polypolish.misc.load_fasta('test/test_misc/test.fasta') | ||
assert len(seqs) == 2 | ||
assert seqs[0][0] == 'A' | ||
assert seqs[0][1].startswith('TTGCCTGTAGTCGGGACC') | ||
assert seqs[1][0] == 'B' | ||
assert seqs[1][1].startswith('ATTCTCAGAATGGCGTAG') | ||
|
||
|
||
def test_load_fasta_2(): | ||
seqs = polypolish.misc.load_fasta('test/test_misc/test.fasta', include_full_header=True) | ||
assert len(seqs) == 2 | ||
assert seqs[0][0] == 'A' | ||
assert seqs[0][1] == 'A info' | ||
assert seqs[0][2].startswith('TTGCCTGTAGTCGGGACC') | ||
assert seqs[1][0] == 'B' | ||
assert seqs[1][1] == 'B stuff' | ||
assert seqs[1][2].startswith('ATTCTCAGAATGGCGTAG') | ||
|
||
|
||
def test_load_fasta_3(): | ||
seqs = polypolish.misc.load_fasta('test/test_misc/test.fasta.gz') | ||
assert len(seqs) == 2 | ||
assert seqs[0][0] == 'A' | ||
assert seqs[0][1].startswith('TTGCCTGTAGTCGGGACC') | ||
assert seqs[1][0] == 'B' | ||
assert seqs[1][1].startswith('ATTCTCAGAATGGCGTAG') | ||
|
||
|
||
def test_load_fasta_4(): | ||
seqs = polypolish.misc.load_fasta('test/test_misc/bad_1.fasta') | ||
assert len(seqs) == 2 | ||
assert seqs[0][0] == 'A' | ||
assert seqs[0][1].startswith('TTGCCTGTAGTCGGGACC') | ||
assert seqs[1][0] == 'B' | ||
assert seqs[1][1].startswith('ATTCTCAGAATGGCGTAG') | ||
|
||
|
||
def test_load_fasta_5(): | ||
seqs = polypolish.misc.load_fasta('test/test_misc/lowercase.fasta') | ||
assert len(seqs) == 2 | ||
assert seqs[0][0] == 'A' | ||
assert seqs[0][1].startswith('TTGCCTGTAGTCGGGACC') | ||
assert seqs[1][0] == 'B' | ||
assert seqs[1][1].startswith('ATTCTCAGAATGGCGTAG') | ||
|
||
|
||
def test_reverse_complement_1(): | ||
assert polypolish.misc.reverse_complement('GGGGaaaaaaaatttatatat') == 'atatataaattttttttCCCC' | ||
|
||
|
||
def test_reverse_complement_2(): | ||
assert polypolish.misc.reverse_complement('atatataaattttttttCCCC') == 'GGGGaaaaaaaatttatatat' | ||
|
||
|
||
def test_reverse_complement_3(): | ||
assert polypolish.misc.reverse_complement('ACGT123') == 'NNNACGT' | ||
|
||
|
||
def test_check_python_version_1(): | ||
with unittest.mock.patch.object(sys, 'version_info') as v_info: | ||
v_info.major = 3 | ||
v_info.minor = 6 | ||
polypolish.misc.check_python_version() | ||
|
||
|
||
def test_check_python_version_2(): | ||
with unittest.mock.patch.object(sys, 'version_info') as v_info: | ||
v_info.major = 3 | ||
v_info.minor = 8 | ||
polypolish.misc.check_python_version() | ||
|
||
|
||
def test_check_python_version_3(): | ||
with pytest.raises(SystemExit) as e: | ||
with unittest.mock.patch.object(sys, 'version_info') as v_info: | ||
v_info.major = 3 | ||
v_info.minor = 5 | ||
polypolish.misc.check_python_version() | ||
assert 'requires Python 3.6 or later' in str(e.value) | ||
|
||
|
||
def test_check_python_version_4(): | ||
with pytest.raises(SystemExit) as e: | ||
with unittest.mock.patch.object(sys, 'version_info') as v_info: | ||
v_info.major = 2 | ||
v_info.minor = 7 | ||
polypolish.misc.check_python_version() | ||
assert 'requires Python 3.6 or later' in str(e.value) | ||
|
||
|
||
def test_get_ascii_art(): | ||
assert "| | | |(_) | |" in polypolish.misc.get_ascii_art() |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,7 @@ | ||
>A | ||
TTGCCTGTAGTCGGGACCCCGTGACTAGGAAAGCAATCAGCGACTAACAGGCGGAGACCGTCTATAGCGCACGGGGTGTAGTTGGCTATTACTGATCTCT | ||
|
||
|
||
|
||
>B | ||
ATTCTCAGAATGGCGTAGTATTCATATTTGTTCGTAGCCCGCCTCCGTACATGTTATTGTGCTCATCGGTGGCCTGCGCCGTGGGGAGTGCAAAACGTGG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,9 @@ | ||
@A info | ||
TTGCCTGTAGTCGGGACCCCGTGACTAGGAAAGCAATCAGCGACTAACAGGCGGAGACCGTCTATAGCGCACGGGGTGTAGTTGGCTATTACTGATCTCT | ||
+ | ||
##$#%#%&++3*&&&-.72:789>;:<74362%&&(%()%$&$$&#(%*'&$%&$%*##$'/-&'&&'%%%'$%#"$#'#$$)##%((#%$('*'$'($' | ||
|
||
@B stuff | ||
ATTCTCAGAATGGCGTAGTATTCATATTTGTTCGTAGCCCGCCTCCGTACATGTTATTGTGCTCATCGGTGGCCTGCGCCGTGGGGAGTGCAAAACGTGG | ||
+ | ||
:;@@AHD98/.5C*-CEC68BHJD/>:@<?>9CA=@??DEIF835<1.*+)<8++1--5?;62<B>9;%3))2/@=BC6651:65.?@>EFBBFNJ@BJK |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,9 @@ | ||
@A info | ||
TTGCCTGTAGTCGGGACCCCGTGACTAGGAAAGCAATCAGCGACTAACAGGCGGAGACCGTCTATAGCGCACGGGGTGTAGTTGGCTATTACTGATCTCT | ||
+ | ||
##$#%#%&++3*&&&-.72:789>;:<74362%&&(%()%$&$$&#(%*'&$%&$%*##$'/-&'&&'%%%'$%#"$#'#$$)##%((#%$('*'$'($' | ||
EXTRA LINE | ||
@B stuff | ||
ATTCTCAGAATGGCGTAGTATTCATATTTGTTCGTAGCCCGCCTCCGTACATGTTATTGTGCTCATCGGTGGCCTGCGCCGTGGGGAGTGCAAAACGTGG | ||
+ | ||
:;@@AHD98/.5C*-CEC68BHJD/>:@<?>9CA=@??DEIF835<1.*+)<8++1--5?;62<B>9;%3))2/@=BC6651:65.?@>EFBBFNJ@BJK |
Empty file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
>A info | ||
ttgcctgtagtcgggaccccgtgactaggaaagcaatcagcgactaacaggcggagaccgtctatagcgcacggggtgtagttggctattactgatctct | ||
>B stuff | ||
attctcagaatggcgtagtattcatatttgttcgtagcccgcctccgtacatgttattgtgctcatcggtggcctgcgccgtggggagtgcaaaacgtgg |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
�vW�l |
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
>A info | ||
TTGCCTGTAGTCGGGACCCCGTGACTAGGAAAGCAATCAGCGACTAACAGGCGGAGACCGTCTATAGCGCACGGGGTGTAGTTGGCTATTACTGATCTCT | ||
>B stuff | ||
ATTCTCAGAATGGCGTAGTATTCATATTTGTTCGTAGCCCGCCTCCGTACATGTTATTGTGCTCATCGGTGGCCTGCGCCGTGGGGAGTGCAAAACGTGG |
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,8 @@ | ||
@A info | ||
TTGCCTGTAGTCGGGACCCCGTGACTAGGAAAGCAATCAGCGACTAACAGGCGGAGACCGTCTATAGCGCACGGGGTGTAGTTGGCTATTACTGATCTCT | ||
+ | ||
##$#%#%&++3*&&&-.72:789>;:<74362%&&(%()%$&$$&#(%*'&$%&$%*##$'/-&'&&'%%%'$%#"$#'#$$)##%((#%$('*'$'($' | ||
@B stuff | ||
ATTCTCAGAATGGCGTAGTATTCATATTTGTTCGTAGCCCGCCTCCGTACATGTTATTGTGCTCATCGGTGGCCTGCGCCGTGGGGAGTGCAAAACGTGG | ||
+ | ||
:;@@AHD98/.5C*-CEC68BHJD/>:@<?>9CA=@??DEIF835<1.*+)<8++1--5?;62<B>9;%3))2/@=BC6651:65.?@>EFBBFNJ@BJK |
Binary file not shown.
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
This is a plain text file. |
Binary file not shown.